software package based on the contin algorithm Search Results


90
Vala Sciences kic analysis package
Kic Analysis Package, supplied by Vala Sciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+package+based+on+the+contin+algorithm/kic+analysis+package/us10682416-350-8-11
Average 90 stars, based on 1 article reviews
kic analysis package - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

98
Addgene inc lentiviral packaging mix pspax2
Lentiviral Packaging Mix Pspax2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+package+based+on+the+contin+algorithm/psPAX2+(Plasmid+%2312260)/pmc05916795__NIHMS958987___supplement___3-219-245-251
Average 98 stars, based on 1 article reviews
lentiviral packaging mix pspax2 - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

97
ATCC packaging plasmids pvsvg
KEY RESOURCES TABLE
Packaging Plasmids Pvsvg, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+package+based+on+the+contin+algorithm/TF-1/pmc07170217-461-36-33
Average 97 stars, based on 1 article reviews
packaging plasmids pvsvg - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

86
Brookhaven Instruments contin software package
KEY RESOURCES TABLE
Contin Software Package, supplied by Brookhaven Instruments, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+package+based+on+the+contin+algorithm/isda+package+software/pm41228603-38-11-14
Average 86 stars, based on 1 article reviews
contin software package - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

96
Addgene inc pmdlg prre lentiviral packaging addgene
KEY RESOURCES TABLE
Pmdlg Prre Lentiviral Packaging Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+package+based+on+the+contin+algorithm/pMDLg%2FpRRE+(Plasmid+%2312251)/10__7554_slash_elife__36097-329-119-122
Average 96 stars, based on 1 article reviews
pmdlg prre lentiviral packaging addgene - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

90
Laser Design Inc datasculpt software
KEY RESOURCES TABLE
Datasculpt Software, supplied by Laser Design Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+package+based+on+the+contin+algorithm/datasculpt++software/us07387511-82-6-10
Average 90 stars, based on 1 article reviews
datasculpt software - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Lynnon corporation dnaman software package
KEY RESOURCES TABLE
Dnaman Software Package, supplied by Lynnon corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+package+based+on+the+contin+algorithm/dnaman+software/10__1128_slash_jb__184__22__6301___6315__2002-114-11-14
Average 90 stars, based on 1 article reviews
dnaman software package - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

99
Thermo Fisher random access same 6 similarities item predicate device phadia 250 test device phadia 2500 5000 reagent packaging size various
KEY RESOURCES TABLE
Random Access Same 6 Similarities Item Predicate Device Phadia 250 Test Device Phadia 2500 5000 Reagent Packaging Size Various, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+package+based+on+the+contin+algorithm/Nunc+Seals/fda_document____cdrh_docs_slash_reviews_slash_k182353-39-176-184
Average 99 stars, based on 1 article reviews
random access same 6 similarities item predicate device phadia 250 test device phadia 2500 5000 reagent packaging size various - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

92
ATCC retroviral packaging cell line
KEY RESOURCES TABLE
Retroviral Packaging Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+package+based+on+the+contin+algorithm/Retroviral+packaging+cell+line%2C+RDF21/pmc05728704-427-219-224
Average 92 stars, based on 1 article reviews
retroviral packaging cell line - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

96
Addgene inc prsv rev lentiviral packaging addgene
KEY RESOURCES TABLE
Prsv Rev Lentiviral Packaging Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+package+based+on+the+contin+algorithm/pRSV-Rev+(Plasmid+%2312253)/10__7554_slash_elife__36097-329-99-102
Average 96 stars, based on 1 article reviews
prsv rev lentiviral packaging addgene - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

90
BioSignal Group biosignal software labview
KEY RESOURCES TABLE
Biosignal Software Labview, supplied by BioSignal Group, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+package+based+on+the+contin+algorithm/biosignal+analysis+software/pmc03612941-59-13-11
Average 90 stars, based on 1 article reviews
biosignal software labview - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

96
Addgene inc lab n a dvpr lentiviral packaging plasmid addgene 8455 vsv g envelope plasmid addgene 8454 software
KEY RESOURCES TABLE
Lab N A Dvpr Lentiviral Packaging Plasmid Addgene 8455 Vsv G Envelope Plasmid Addgene 8454 Software, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+package+based+on+the+contin+algorithm/pCMV-dR8%2E2+dvpr+(Plasmid+%238455)/pm36093380-337-83-89
Average 96 stars, based on 1 article reviews
lab n a dvpr lentiviral packaging plasmid addgene 8455 vsv g envelope plasmid addgene 8454 software - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Cell reports

Article Title: Mitochondrial Pyruvate Carrier 1 Promotes Peripheral T Cell Homeostasis through Metabolic Regulation of Thymic Development

doi: 10.1016/j.celrep.2020.02.042

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Cell Lines To generate MPC1 KO Jurkat T cells, CRISPR/Cas9 lentivector infections were performed as described ( Wallace et al., 2016 , 2017 ) by utilizing Trans-IT 293 (Mirus) to transfect 293T cells (ATCC) with the packaging plasmids pVSVg ( Stewart et al., 2003 ) and psPAX2 along with the CRISPR/Cas9 lentiCRISPRv2 construct ( Sanjana et al., 2014 ) (Addgene plasmid #52961) containing a GFP selection marker and one specific short guide RNA sequence against human MPC1 (MPC1-CR1, 5′-GTCGTGAGGCGGGCCTTCG GGCTGGCTCGCCGTCGGCTGCCGGGGGGTTGGCCGGGGTGTCATTGGCTCTGGGAA GCGGCAGCAGAGGCAGGGACCACTC GGGGTCTGGTGTCGGCACAGCCATGGCGGGC GCGTTGGTGCGGAAAGCGGCGGACTATGTCCGAAGCAAGGATTTCCGGGAC TACCTCA TGAGGTGACGAGCGCCGCAGGCCGAACCC-3′) or an empty vector (EV).

Techniques: Staining, Plasmid Preparation, Recombinant, CRISPR, Construct, Software

KEY RESOURCES TABLE

Journal: Developmental cell

Article Title: Macrophage-dependent cytoplasmic transfer during melanoma invasion in vivo

doi: 10.1016/j.devcel.2017.11.003

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Chicken polyclonal anti-GFP Abcam Cat#: ab13970 Mouse monoclonal anti-ZO-1 Life Technologies Cat#: 33-9100 Mouse monoclonal anti-MITF Abcam Cat#: ab12039 Rabbit polyclonal anti-dsRed Clontech Cat#: 632496 Bacterial and Virus Strains N/A N/A N/A Biological Samples N/A N/A N/A Chemicals, Peptides, and Recombinant Proteins Dako serum free block Agilent Cat#: X090930-2 DAPI Sigma Cat#: D9542 TissueTek Optimum Cutting Temperature Compound VWR Cat#: 25608-930 Prolong Gold antifade reagent Molecular Probes Cat#: P36934 Recombinant human M-CSF Peprotech Cat#: 300-25 eBioscience Fixable Viability Dye eFluor 780 Thermofisher Cat#: 65-0865-14 Lipopolysaccharide InvivoGen Cat#: R595 Collagenase Type I Worthington Biochemical Cat#: LS004194 DNase Worthington Biochemical Cat#: LS006361 Hyaluronidase Sigma Cat#: H3506 Red Blood Cell Lysis Buffer Biolegend Cat#: 420301 Critical Commercial Assays Incucyte zoom system Essen Bioscience Cat#: 4647 SP6 mMessage mMachine Life Technologies Cat#: AM1340 Lipofectamine 3000 Invitrogen Cat#: L3000001 Golden Gate TALEN and TAL effector kit Addgene Cat#: 1000000024 Deposited Data N/A N/A N/A Experimental Models: Cell Lines Human melanoma cells: A375P ATCC Cat#: CRL3224 Human melanoma cells: A375M1 ATCC Cat#: CRL3222 Human melanoma cells: WM266-4 Rockland Cat#: WM266-4-01-0001 Human melanoma cells: 1205Lu Coriell Institute Cat#: WC00058 Human melanoma cells: WM793 Coriell Institute Cat#: WC00062 Murine melanoma cells: B16F10 ATCC Cat#: CRL-6475 Human epithelial cells: MCF10A ATCC Cat#: CRL-10317 Murine intestinal cancer cells: MC-38 Kerafast Cat#: ENH204 MLV-based retroviral packaging cell line: PT67 ATCC Cat#: CRL-12284 Human melanoma cells: Mel-624 Laboratory of Randall Moon N/A Zebrafish melanoma cells: Zmel Laboratory of Richard White Heilman et al., 2015 .

Techniques: Virus, Recombinant, Blocking Assay, Red Blood Cell Lysis, Retroviral, Sequencing, Mutagenesis, Binding Assay, CRISPR, Plasmid Preparation, Software