Journal: Cell reports

Article Title: Mitochondrial Pyruvate Carrier 1 Promotes Peripheral T Cell Homeostasis through Metabolic Regulation of Thymic Development

doi: 10.1016/j.celrep.2020.02.042

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Cell Lines To generate MPC1 KO Jurkat T cells, CRISPR/Cas9 lentivector infections were performed as described ( Wallace et al., 2016 , 2017 ) by utilizing Trans-IT 293 (Mirus) to transfect 293T cells (ATCC) with the packaging plasmids pVSVg ( Stewart et al., 2003 ) and psPAX2 along with the CRISPR/Cas9 lentiCRISPRv2 construct ( Sanjana et al., 2014 ) (Addgene plasmid #52961) containing a GFP selection marker and one specific short guide RNA sequence against human MPC1 (MPC1-CR1, 5′-GTCGTGAGGCGGGCCTTCG GGCTGGCTCGCCGTCGGCTGCCGGGGGGTTGGCCGGGGTGTCATTGGCTCTGGGAA GCGGCAGCAGAGGCAGGGACCACTC GGGGTCTGGTGTCGGCACAGCCATGGCGGGC GCGTTGGTGCGGAAAGCGGCGGACTATGTCCGAAGCAAGGATTTCCGGGAC TACCTCA TGAGGTGACGAGCGCCGCAGGCCGAACCC-3′) or an empty vector (EV).

Techniques: Staining, Plasmid Preparation, Recombinant, CRISPR, Construct, Software

Journal: Developmental cell

Article Title: Macrophage-dependent cytoplasmic transfer during melanoma invasion in vivo

doi: 10.1016/j.devcel.2017.11.003

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Chicken polyclonal anti-GFP Abcam Cat#: ab13970 Mouse monoclonal anti-ZO-1 Life Technologies Cat#: 33-9100 Mouse monoclonal anti-MITF Abcam Cat#: ab12039 Rabbit polyclonal anti-dsRed Clontech Cat#: 632496 Bacterial and Virus Strains N/A N/A N/A Biological Samples N/A N/A N/A Chemicals, Peptides, and Recombinant Proteins Dako serum free block Agilent Cat#: X090930-2 DAPI Sigma Cat#: D9542 TissueTek Optimum Cutting Temperature Compound VWR Cat#: 25608-930 Prolong Gold antifade reagent Molecular Probes Cat#: P36934 Recombinant human M-CSF Peprotech Cat#: 300-25 eBioscience Fixable Viability Dye eFluor 780 Thermofisher Cat#: 65-0865-14 Lipopolysaccharide InvivoGen Cat#: R595 Collagenase Type I Worthington Biochemical Cat#: LS004194 DNase Worthington Biochemical Cat#: LS006361 Hyaluronidase Sigma Cat#: H3506 Red Blood Cell Lysis Buffer Biolegend Cat#: 420301 Critical Commercial Assays Incucyte zoom system Essen Bioscience Cat#: 4647 SP6 mMessage mMachine Life Technologies Cat#: AM1340 Lipofectamine 3000 Invitrogen Cat#: L3000001 Golden Gate TALEN and TAL effector kit Addgene Cat#: 1000000024 Deposited Data N/A N/A N/A Experimental Models: Cell Lines Human melanoma cells: A375P ATCC Cat#: CRL3224 Human melanoma cells: A375M1 ATCC Cat#: CRL3222 Human melanoma cells: WM266-4 Rockland Cat#: WM266-4-01-0001 Human melanoma cells: 1205Lu Coriell Institute Cat#: WC00058 Human melanoma cells: WM793 Coriell Institute Cat#: WC00062 Murine melanoma cells: B16F10 ATCC Cat#: CRL-6475 Human epithelial cells: MCF10A ATCC Cat#: CRL-10317 Murine intestinal cancer cells: MC-38 Kerafast Cat#: ENH204 MLV-based retroviral packaging cell line: PT67 ATCC Cat#: CRL-12284 Human melanoma cells: Mel-624 Laboratory of Randall Moon N/A Zebrafish melanoma cells: Zmel Laboratory of Richard White Heilman et al., 2015 .

Techniques: Virus, Recombinant, Blocking Assay, Red Blood Cell Lysis, Retroviral, Sequencing, Mutagenesis, Binding Assay, CRISPR, Plasmid Preparation, Software